This version of the osu! site is read-only.

Beatmap Listing » Yakushimaru Etsuko - I'm Humanity

ATATCCGGGAATTGATATGTACAATTTCGGATAGGCCCATTAATGGATTAACAATGAATTTCGGACCTACGCAGGCTAAA

Artist:

Yakushimaru Etsuko

Circle Size:

Approach Rate:

Title:

I'm Humanity

HP Drain:

Star Difficulty:

(2.55)

Creator:

Deppyforce

Accuracy:

Length:

4:26 (4:11 drain)

Source:

Ars Electronica STARTS Prize 2017

Genre:

Pop (Japanese)

BPM:

129

Tags:

i am im watashi wa jinrui japanese pop j-pop jpop electronic experimental dna kenpoku art 2016 アルスエレクトロニカ s+t+arts 相対性理論 soutaiseiriron

User Rating:

Success Rate:
Points of Failure:
(graph is accumulative, based on % at fail/retry)

16.8% (2638 of 15679 plays)

Submitted:
Ranked:

Feb 23, 2023
Apr 13, 2023

Rating Spread:

Favourited 111 times in total

Users that love this map: AgentYous, - Estella -, tse6969, Agnes Digital, natetheneet, G1332, Feli, NoGari, Troponoop, Crystal Enjoyer, MiraMda, dumtea, Xeeloom, Parato, raggedyandy, Ihram-San, Kryterion, FiddleMinger, JGLF, JayAreEee and many more!

Options:

Modding / Discussion

"apple is red. red is stop light. stop it, stop it, stop the evolution."

for ranked (rdy!!!) surely this is an insane diff

actually ar0 is way too high for this map, intended for at least 2250ms approach time but think of it as a nerf for playability ig

check this mapset out if you want a more user friendly map:
beatmapsets/1239987#osu/2577941

wafer 1st b n aistre 2

Len is in the lead! (2023-11-06 13:59:58 UTC)
Score	20,529,035 (99.95%)
Max Combo	1205
300 / 100 / 50	1173 / 32 / 746
Misses	0
Geki (Elite Beat!)	86
Droplet misses	1
Mods	HR,DT

Top 50 Scoreboard

	Score	Accuracy	Player	Max Combo	300 / 100 / 50	Geki	Droplet Miss	Misses	Mods
#1	20,529,035	99.95%	Len	1205	1173 / 32 / 746	86	1	0	HR,DT
#2	20,527,945	100.00%	FruktoLove	1205	1173 / 32 / 747	86	0	0	HR,NC
#3	19,399,972	100.00%	ERROR CODE 0x7A	1205	1173 / 32 / 747	86	0	0	HR,SD
#4	19,398,842	99.85%	Chloebe	1205	1173 / 32 / 744	86	3	0	HR
#5	19,396,672	100.00%	Arctaroll	1205	1173 / 32 / 747	86	0	0	HR
#6	19,383,472	100.00%	-ExGon-	1205	1173 / 32 / 747	86	0	0	HR,PF
#7	19,381,042	98.82%	buttface123	1205	1173 / 32 / 724	86	23	0	HR
#8	17,352,934	100.00%	yoraze	1205	1173 / 32 / 747	86	0	0	None
#9	17,348,534	100.00%	Nizlish	1205	1173 / 32 / 747	86	0	0	None
#10	9,398,682	99.85%	Zak	631	1170 / 32 / 747	84	0	3	HR
#11	9,394,940	100.00%	DNQ	1205	1173 / 32 / 747	86	0	0	EZ,DT
#12	9,389,085	99.85%	Hibari_Yagyu	599	1170 / 32 / 747	84	0	3	HR,DT
#13	8,193,747	99.85%	Lethal Injectio	545	1171 / 32 / 746	84	1	2	HR
#14	7,479,825	99.64%	Chatie	614	1167 / 32 / 746	82	1	6	HR,DT
#15	7,146,883	99.64%	X a v y	615	1168 / 32 / 745	82	2	5	HR
#16	6,389,042	99.54%	ERA Nikolai	534	1165 / 32 / 746	80	1	8	HR,FL
#17	6,117,489	100.00%	Sfenne	1205	1173 / 32 / 747	86	0	0	HR,HT,PF
#18	5,514,198	99.80%	arm foot	454	1169 / 32 / 747	82	0	4	None
#19	5,287,395	99.44%	Sorryc	396	1166 / 32 / 743	81	4	7	HR,DT,FL
#20	5,238,705	99.33%	Chigusa Asuha	496	1165 / 32 / 742	79	5	8	HR,DT
#21	5,140,712	99.28%	-NGNL-	534	1163 / 32 / 743	77	4	10	HR
#22	4,930,859	99.69%	yeeeter	454	1168 / 32 / 746	81	1	5	HR
#23	4,768,898	99.59%	Niisan	468	1167 / 32 / 745	80	2	6	None
#24	4,587,504	99.49%	Cowboy	461	1166 / 32 / 744	80	3	7	DT
#25	4,038,755	99.64%	Physo	377	1166 / 32 / 747	79	0	7	HR
#26	3,716,894	99.33%	nouserwastaken	328	1164 / 32 / 743	78	4	9	None
#27	3,642,353	99.33%	yxn	282	1162 / 32 / 745	77	2	11	HR
#28	3,511,296	99.23%	uniqly	374	1161 / 32 / 744	77	3	12	None
#29	3,022,705	98.57%	-RogueAssassiN-	325	1155 / 32 / 737	73	10	18	HR
#30	2,974,200	99.95%	Rukairi	1205	1173 / 32 / 746	86	1	0	EZ,HT
#31	2,691,878	98.72%	Strict_Lane	241	1158 / 32 / 737	76	10	15	None
#32	2,478,770	99.08%	-liunya	226	1159 / 32 / 743	75	4	14	None
#33	2,454,872	98.16%	Toileri	241	1150 / 32 / 734	70	13	23	HR,FL
#34	2,449,127	98.46%	janito	225	1150 / 32 / 740	69	7	23	HR,DT
#35	2,433,648	98.31%	ludeath20	226	1145 / 32 / 742	68	5	28	DT
#36	2,324,017	97.75%	Azakriel	239	1145 / 32 / 731	67	16	28	HR,DT
#37	2,323,718	98.51%	MiniCube	197	1156 / 32 / 735	71	12	17	HR
#38	2,211,970	98.67%	nosexd12	230	1157 / 32 / 737	71	10	16	None
#39	2,107,325	97.75%	Yurgin	266	1147 / 32 / 729	64	18	26	DT
#40	2,063,048	98.98%	Syuupp	157	1158 / 32 / 742	73	5	15	None
#41	2,027,778	98.46%	Mati2312_OsuXD	211	1146 / 32 / 744	65	3	27	HR
#42	2,017,571	97.18%	Fastarost	192	1131 / 32 / 734	62	13	42	DT
#43	1,997,098	97.95%	pozzitifosha	186	1149 / 32 / 731	71	16	24	None
#44	1,971,782	98.05%	Rosa	208	1144 / 32 / 738	64	9	29	HR,DT,FL
#45	1,729,326	97.23%	xuneri	151	1136 / 32 / 730	62	17	37	DT
#46	1,694,462	100.00%	BIG H ZONDA KIT	1205	1173 / 32 / 747	86	0	0	NF,EZ,HT
#47	1,679,896	97.54%	-Special-	217	1134 / 32 / 738	63	9	39	None
#48	1,640,084	97.13%	raiderlul	168	1130 / 32 / 734	62	13	43	DT
#49	1,563,676	97.54%	NO37	148	1137 / 31 / 736	61	11	37	HD
#50	1,557,996	96.93%	Usagi58	161	1135 / 31 / 726	60	21	39	None

Beatmap comments are now available only on the new site.
Please go check them out!