This version of the osu! site is read-only.

Beatmap Listing » Yakushimaru Etsuko - I'm Humanity

ATATCCGGGAATTGATATGTACAATTTCGGATAGGCCCATTAATGGATTAACAATGAATTTCGGACCTACGCAGGCTAAA

Artist:

Yakushimaru Etsuko

Circle Size:

Approach Rate:

Title:

I'm Humanity

HP Drain:

Star Difficulty:

(2.78)

Creator:

Deppyforce

Accuracy:

Length:

4:26 (4:11 drain)

Source:

Ars Electronica STARTS Prize 2017

Genre:

Pop (Japanese)

BPM:

129

Tags:

i am im watashi wa jinrui japanese pop j-pop jpop electronic experimental dna kenpoku art 2016 アルスエレクトロニカ s+t+arts 相対性理論 soutaiseiriron

User Rating:

Success Rate:
Points of Failure:
(graph is accumulative, based on % at fail/retry)

16.8% (2638 of 15679 plays)

Submitted:
Ranked:

Feb 23, 2023
Apr 13, 2023

Rating Spread:

Favourited 111 times in total

Users that love this map: AgentYous, - Estella -, tse6969, Agnes Digital, natetheneet, G1332, Feli, NoGari, Troponoop, Crystal Enjoyer, MiraMda, dumtea, Xeeloom, Parato, raggedyandy, Ihram-San, Kryterion, FiddleMinger, JGLF, JayAreEee and many more!

Options:

Modding / Discussion

"apple is red. red is stop light. stop it, stop it, stop the evolution."

for ranked (rdy!!!) surely this is an insane diff

actually ar0 is way too high for this map, intended for at least 2250ms approach time but think of it as a nerf for playability ig

check this mapset out if you want a more user friendly map:
beatmapsets/1239987#osu/2577941

wafer 1st b n aistre 2

Erio is in the lead! (2023-04-14 05:02:49 UTC)
Score	997,005 (100.00%)
Max Combo	2210
MAX / 300 / 200	1217 / 129 / 0
100 / 50 / Misses	0 / 0 / 0
Mods	None

Top 50 Scoreboard

	Score	Accuracy	Player	Max Combo	MAX	300	200	100	50	Miss		Mods
#1	997,005	100.00%	Erio	2210	1217	129	0	0	0	0	None	Report
#2	907,320	98.37%	haha i rolypoly	699	895	411	24	5	2	9	None	Report
#3	884,380	97.97%	Mati2312_OsuXD	643	782	507	41	5	4	7	None	Report
#4	870,962	97.40%	yikiwawa00	816	723	545	59	10	2	7	None	Report
#5	837,695	99.63%	Shbyssal	1516	763	569	12	0	0	1	5K	Report
#6	828,009	99.21%	tiramiss052	1418	895	423	24	1	0	2	5K	Report
#7	818,958	100.00%	SubTheEevee	2176	1180	50	0	0	0	0	PF,4K	Report
#8	814,848	99.97%	Lama2310	2157	997	232	1	0	0	0	4K	Report
#9	813,001	99.97%	tfinnalyl	2160	909	320	1	0	0	0	NC,4K	Report
#10	811,007	99.92%	BaconBananaGuy	2157	843	384	3	0	0	0	4K	Report
#11	809,820	99.78%	Fravami	2129	865	357	8	0	0	0	4K	Report
#12	808,398	99.78%	Ricegrains	2153	794	428	8	0	0	0	4K	Report
#13	806,462	99.73%	artep 169	2174	740	481	8	1	0	0	4K	Report
#14	802,673	99.59%	Hingesy	2083	879	338	12	0	0	1	4K	Report
#15	800,066	99.30%	waiofe	2171	687	518	24	1	0	0	4K	Report
#16	795,688	99.13%	VoidFX	2156	620	579	30	1	0	0	4K	Report
#17	790,863	99.02%	UniserverCommon	1320	769	430	27	2	2	0	4K	Report
#18	783,636	99.11%	-FeeYu-	936	829	378	18	0	0	5	4K	Report
#19	773,381	95.11%	miner6580	311	714	513	71	12	11	25	None	Report
#20	734,532	95.06%	z7546123	442	518	689	102	12	3	22	None	Report
#21	726,258	97.37%	Kaiokhoa	913	651	511	49	9	0	10	4K	Report
#22	710,798	96.49%	mxddxrkY	656	621	510	78	10	3	8	4K	Report
#23	681,107	96.31%	KrissU13	997	748	397	55	6	6	18	4K	Report
#24	673,312	95.89%	Kreid	578	706	432	57	9	3	23	4K	Report
#25	662,082	92.10%	lowelldave	278	512	618	145	32	14	25	None	Report
#26	565,106	91.87%	fluffy_bunss	515	454	571	139	33	8	25	4K	Report
#27	553,188	92.10%	Reiixu	515	456	580	130	28	5	31	4K	Report
#28	540,180	84.04%	88mareen88	210	408	569	199	56	17	97	None	Report
#29	522,861	91.54%	nyaker	316	468	545	151	32	10	24	4K	Report
#30	497,994	83.11%	HazardEST	138	433	539	182	58	36	98	None	Report
#31	463,844	78.33%	emppu	175	360	512	224	78	42	130	None	Report
#32	438,911	86.65%	Komairo	525	418	468	232	63	25	24	4K	Report
#33	437,420	74.68%	Bottle of sauce	202	364	474	196	84	51	177	None	Report
#34	429,208	85.41%	MissingNo97	399	345	558	178	68	37	44	4K	Report
#35	399,032	71.55%	zxcYae	119	274	474	263	89	60	186	None	Report
#36	379,606	78.56%	chqwiqi	347	313	482	212	69	42	112	4K	Report
#37	361,960	94.79%	Rukairi	398	532	695	67	9	7	36	HD,HT,MR	Report
#38	317,326	71.68%	manikk	195	227	407	292	131	56	117	4K	Report
#39	282,442	53.19%	OdaTGUnifier	113	171	318	270	102	78	407	None	Report
#40	239,676	45.60%	techmaster	69	120	303	204	103	123	493	NC	Report
#41	220,665	42.38%	dsd229	111	129	221	234	137	113	512	None	Report
#42	189,306	36.55%	izumi13324	83	104	202	190	121	114	615	None	Report
#43	166,111	74.09%	yhh_ex	315	265	403	297	111	50	104	NF,4K	Report

Beatmap comments are now available only on the new site.
Please go check them out!